[Sis290025]

I am reviewing an example on the basics of the genetic code; this example is listed at the bottom of the following webpage: https://www.atdbio.com/content/14/Transcription-Translation-and-Replication.

I have produced the example below and added Roman numerals to better indicate the parts that I am questioning (V and VII).

One strand of genomic DNA (strand A, coding strand) contains the following sequence reading from 5′- to 3′-:

  I. TCGTCGACGATGATCATCGGCTACTCGA

This strand will form the following duplex:

 II. 5′-TCGTCGACGATGATCATCGGCTACTCGA-3'
III. 3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5'

The sequence of bases in the other strand of DNA (strand B) written 5′- to 3′- is therefore

 IV. TCGAGTAGCCGATGATCATCGTCGACGA

The sequence of bases in the mRNA transcribed from strand A of DNA written 5′- to 3′- is

  V. UCGAGUAGCCGAUGAUCAUCGUCGACGA

The amino acid sequence coded by the above mRNA is

 VI. Ser-Ser-Ser-Arg-STOP

However, if DNA strand B is the coding strand the mRNA sequence will be:

VII.  UCGUCGACGAUGAUCAUCGGCUACUCGA

and the amino-acid sequence will be:

VIII. Ser-Ser-Thr-Arg-Ser-Ser-Gly-Cys-Ser-

I understand that Strand A (5' -> 3') is this:

5′-TCGTCGACGATGATCATCGGCTACTCGA-3'.

However, if the above is (or designated) the coding strand, then why is the mRNA sequence (following transcription) not this (see below)?

5'-UCGUCGACGAUGAUCAUCGGCUACUCGA-3'  (Thought One)

I thought that the defining trait of the DNA coding strand is that its base sequence is almost the same as the resulting mRNA sequence, with the exception that uracil (U) substitutes for thymine (T). 

I have the same question for Strand B (see IV):
5'-TCGAGTAGCCGATGATCATCGTCGACGA-3'.

Why is the mRNA sequence of Strand B, if it is coding, not:
5'-UCGAGUAGCCGAUGAUCAUCGUCGACGA-3'  (Thought 2)?

(Although Strand B is the template strand in III, it clearly states later to assume that it is coding.)


As you may notice, my Thoughts 1 and 2 (for Strands A and B, respectively) are the switched answers for V and VII. That is, what I thought was the correct mRNA sequence corresponding to Strand A (see Thought 1) is actually the listed mRNA sequence that corresponds to Strand B (see VII).

I really appreciate your help on where I went wrong.

Thank you

[Babcock_Hall]

I might have time to come back to this question later, but for now I just have time for two general points.  One, the non-template strand is the coding strand.  The template strand is complementary to the messenger RNA being synthesized.  Two, this problem asks one to consider two different alternatives with respect to the coding strand.  It seems to me that one is being asked to swap the functions of the two strands.