November 21, 2024, 05:20:25 PM
Forum Rules: Read This Before Posting


« previous next »
Pages: [1]   Go Down

Topic: How to write the polypeptide resulting from the nucleotide sequence ?  (Read 2019 times)

0 Members and 1 Guest are viewing this topic.

Offline AussieKenDoll

  • Full Member
  • ****
  • Posts: 123
  • Mole Snacks: +0/-0
How to write the polypeptide resulting from the nucleotide sequence ?
« on: May 10, 2019, 06:13:03 AM »
How to write the  polypeptide resulting from the nucleotide sequence given of TTGACAGGAGTGCACAGCCATCGC
Logged

Offline Babcock_Hall

  • Chemist
  • Sr. Member
  • *
  • Posts: 5704
  • Mole Snacks: +330/-24
Re: How to write the polypeptide resulting from the nucleotide sequence ?
« Reply #1 on: May 10, 2019, 10:44:14 AM »
Do you know what the genetic code is?
Logged
Pages: [1]   Go Up
« previous next »
Sponsored Links