January 15, 2025, 04:20:06 AM
Forum Rules: Read This Before Posting


Topic: base sequence of complementary DNA strands  (Read 24210 times)

0 Members and 2 Guests are viewing this topic.

Offline ixi

  • Regular Member
  • ***
  • Posts: 49
  • Mole Snacks: +0/-7
base sequence of complementary DNA strands
« on: May 02, 2009, 07:30:36 PM »
One strand of a double helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand.

Answer:
The complementary strand is
(5')GCGCAATATTTTGAGAAATATTGCGC(3')

-----------------------------------
(5')GCGCAATATTTCTCAAAATATTGCGC(3')
(5')GCGCAATATTTTGAGAAATATTGCGC(3')  --> Complementary strand


I don't understand this problem. I thought since the strand that's given is from 5' to 3', the complementary strand would be from 3' to 5'.  Also, I thought it was always A with T and C with C.

Help please

Offline sjb

  • Global Moderator
  • Sr. Member
  • ***
  • Posts: 3653
  • Mole Snacks: +222/-42
  • Gender: Male
Re: base sequence of complementary DNA strands
« Reply #1 on: May 03, 2009, 06:19:58 AM »
One strand of a double helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand.

Answer:
The complementary strand is
(5')GCGCAATATTTTGAGAAATATTGCGC(3')

-----------------------------------
(5')GCGCAATATTTCTCAAAATATTGCGC(3')
(5')GCGCAATATTTTGAGAAATATTGCGC(3')  --> Complementary strand


I don't understand this problem. I thought since the strand that's given is from 5' to 3', the complementary strand would be from 3' to 5'.  Also, I thought it was always A with T and C with C.

Help please

In the first part, conventionally, you write NA strands from 5' to 3'. If you write the second strand 3' to 5' I think you see your pairing that you predict (A/T and G/C).

S

Offline ixi

  • Regular Member
  • ***
  • Posts: 49
  • Mole Snacks: +0/-7
Re: base sequence of complementary DNA strands
« Reply #2 on: May 03, 2009, 10:45:41 AM »
ooh i see. I wrote it from 3' to 5' but it's the same thing only reversed.

Thanks :)

Sponsored Links